hohuoywih5525 hohuoywih5525
  • 03-06-2018
  • Social Studies
contestada

Interest groups are likely to be least important in which political culture

Respuesta :

claudettoterohil
claudettoterohil claudettoterohil
  • 07-06-2018
Your answer would be, MORALISTIC....




Hope that helps!!!
Answer Link

Otras preguntas

Why did the french revolution happen and who's fault was it
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
who was the founder of Pennsylvania?
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number
The Earth has four main seasons: winter, spring, summer, and fall. Which of the following is a cause of seasonal changes on Earth? The Earth rotates. The
A generator stores electric current. Explain why you agree or disagree with this statement