01-10-2018
Physics

contestada

as energy is added to a soild the atoms dash and move apart ?

Respuesta :

ripperchristdar ripperchristdar

01-10-2018

if its a solid the atoms in it should NOT move apart.

Answer Link

Otras preguntas

NEED HELP FAST!!! The difference of the values of the third quartile and the median of the data set represented by the box plot is (Pictured Below)

What is the distance between points (21, -32) and (-3, -25)?

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

What is the value of x?

One member of the debate team is going to be chosen president. each member is equally likely to be chosen. the probability that a girl is chosen is 2/3 the prob

Which two states were admitted to the united states as part of the missouri compromise?

the value x+x(x×) when x = 2

The chloroplast found within a photosynthetic protist is surrounded by four membranes. how can we account for this

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

What is the distance between points (21, -32) and (-3, -25)?