trentdominique6
trentdominique6 trentdominique6
  • 04-01-2021
  • Mathematics
contestada

For the problem 4 x 2/3, Dawn says the answer is 6. Marry Anne says the answer is 3 1/3. Stacy says it is 2 2/3. Who is correct?

Respuesta :

mhanifa
mhanifa mhanifa
  • 04-01-2021

Answer:

  • Stacy is correct

Step-by-step explanation:

Solving the problem

  • 4×2/3 =
  • 8/3 =
  • 2 2/3

Stacy is correct

Answer Link
manissaha129
manissaha129 manissaha129
  • 09-01-2021

Answer:

[tex]\huge 4 \times \frac{2}{3} = \frac{8}{3} =\boxed{2 \frac{2}{3} }[/tex]

Hence, Stacy is correct.

Answer Link

Otras preguntas

Which are True or False ?
Which country use tax brackets as part of their tax system? canada australia south africa all of the above?
How many meters are there in 21 feet?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
cody has 7/8 pound of cheese. he uses 1/7 since there are 16 ounces in a pound how much is left
100 points to whoever answers this question!! Five countries are competing in the high jump at the Olympics. Each country reached a certain height (in meters) f
How do the structures of alveoli and capillaries support the function of gas exchange?
Which factor controls the water cycle? A. Energy from the sun B. Changing ocean currents C. Volcanic eruptions D. Burning of fossil fuels
how is an error within an EMR corrected
Solve for x and y: x-3y=-8 3x+2y=31