Seudónimo Seudónimo
  • 04-01-2021
  • English
contestada

Don't go, don't go to sleep
Don't go, stay up and don't go



im sad i just want some one to talk tooo

Dont go dont go to sleep Dont go stay up and dont go im sad i just want some one to talk tooo class=

Respuesta :

berbua7a3s berbua7a3s
  • 04-01-2021

Answer:Just sleep just sleep

Explanation:Put ur head down and just sleep

Answer Link
ashlee100
ashlee100 ashlee100
  • 04-01-2021
I felt this, school is rlly draining..
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
A standard coffee mug has a capacity of 16 fluid ounces. If Annie needs to fill 26 mugs with coffee, how many total quarts of coffee does she need?
Can someone explain the equation Q = M C delta T or Q = MCΔT Thanks!
what might be learned from an incorrect hypothesis
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
What property is shown by the equation? 1. 0 ÷ (–6) = 0
On a new construction site, an electrician can install a new light fixture in 20 minutes. A project calls for 24 new fixtures to be installed on each of 4 floor
Why were the committees of correspondence powerful?