thisisntdede thisisntdede
  • 01-06-2021
  • Mathematics
contestada

Identify the vertex:
f (x) = -x^2+ 10x

Respuesta :

jaidaword92ouv3ll jaidaword92ouv3ll
  • 01-06-2021

Answer:

(5,25)

Step-by-step explanation:

Answer Link

Otras preguntas

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
how many moles of NaCl are equivalent to 15.6g NaCl
What is the interquartile range of the data? 17, 18, 18, 20, 23, 25, 27, 27, 34, 38, 40, 46, 46, 62, 67
The octet rule states that, in chemical compounds, atoms tend to have ____. the electron configuration of a noble gas more protons than electrons eight electron
Read the following excerpt from Sandra Cisneros’s story "Mericans." They’re not from here. Ladies don’t come to church dressed in pants. And everybody knows me
Your religious identity is only important for you within your family and does not matter in the public sphere.
During the cross-bridge cycle, after the calcium binds to troponin, what happens next?
What was one of the two major goals that the national organization for women work towards when it was first founded?
Arrange the steps in the correct order for creating a digital image and saving it.