carrot1012005
carrot1012005 carrot1012005
  • 02-07-2021
  • Chemistry
contestada

Methanoic acid is the simplest carboxylic acid molecule. It has one carbon atom. Draw the structural model for methanoic acid (using C and H).

Respuesta :

naidoojadine05
naidoojadine05 naidoojadine05
  • 02-07-2021

ANSWER IS ABOVE

THE METHANOIC ACID

Ver imagen naidoojadine05
Answer Link

Otras preguntas

This is 8th grade math but I don't know how do this put please help me![tex]1.2 \times {10}^{ - 3} \div 4 \times {10}^{6} [/tex]​
Which element is located in group 4 period 3 on the periodic Table?
The mRNA generated below was produced in the of the cell. 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
Please please please help me asap!
Why is Hawaii Volcanoes National Park valuables to the United States?
How do you the ancient Egyptians increase their powers and wealth
Find g(a - 1) when g(x) = 5x - 4.
Research a topic about programming structures.
There are three homes being built, each with an identical deck on the back. Each deck is comprised of two separate areas. One area is 112.5 square feet, while t
Identify the quotient and the remainder. (24x3 − 14x2 20x 6) ÷ (4x2 − 3x 5) = Q R 4x2 − 3x 5 Q = R =