tammiemurphy1432
tammiemurphy1432 tammiemurphy1432
  • 03-10-2021
  • Mathematics
contestada

Help me with this please

Help me with this please class=

Respuesta :

ferrybukantoro
ferrybukantoro ferrybukantoro
  • 03-10-2021

Step-by-step explanation:

the area of CDE = 42°/360° ×π×11²

= 7/60 × 3.14 × 121

= 44.33 sq. units

Answer Link

Otras preguntas

Los deportistas profesionales ____ el pago por si desempeño. recibe reciben reciban reciba
Characteristics of the early u.s. navy "super frigates" included ______________. select all that apply.
Would someone please help me with my french? Thank you! Fill in the blank after reading the options and looking at the pictures. I will type out the options her
Lucilla wondered what the average weight of each orange was in a five-pound bag of oranges. she purchased six bags and calculated the average weight for a singl
In the Chinese civil war 1945-1949 support for Mao Zedongs communist forces came primarily from the
Help plsssssssssssss
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Dante has a vegetable garden. He places several earthworms in the garden’s soil. Which statement explains the most likely reason Dante puts worms in his garde
Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income
For which of the following materials is necessary to stop a beta particle? A. Three feet of concrete B. Three inches of lead C. Thin pieces of wood D. Single s