makaylahoop70 makaylahoop70

01-04-2022
Mathematics

contestada

Reflect (-5,-3) over the -axis.
Then translate the result down 2 units.
What are the coordinates of the final point?

Respuesta :

DayjaRutherford101 DayjaRutherford101

01-04-2022

Answer:

(-5,-1)

Step-by-step explanation:

Answer Link

Otras preguntas

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

Frozen water (ice) has less density than liquid water. How does this property of water affect life on Earth?

the volume of a sphere is 2254 pi ^3 what is the surface area of the sphere

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Fill in each blank with mitosis or meiosis. humans produce gametes by the process of __________________. a zygote becomes a fetus by the process of_____________

Write about the formation of Himalayas

PLEASE HELP ASAP A diagonal length of a rhombus is multiplied by 2/3. Which of the following describes the effect of this change on the area?

Please help me with this

Why is plagiarism a violation of ethics? a. it makes psychology researchers look bad. b. it violates an apa standard. c. it is akin to lying. d. it violates a b

help quick please!! Thanks